27.5: Translation of RNA- Protein Biosynthesis Last updated Save as PDF Page ID424473 \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \) \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \) \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\) \( \newcommand{\vectorA}[1]{\vec{#1}} % arrow\) \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow\) \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \) \( \newcommand{\vectorC}[1]{\textbf{#1}} \) \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \) \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \) \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \) \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \) \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \) Objectives After completing this section, you should be able to describe, very briefly, the roles of messenger RNA and transfer RNA in the biosynthesis of proteins. Key Terms Make certain that you can define, and use in context, the key terms below. anticodon codon translation Study Notes As in the preceding section, you should not be too concerned about trying to memorize details. The objective requires you to have a general understanding of the roles played by mRNA and tRNA in the biosynthesis of proteins, and that you be able to describe this process. One of the definitions of a gene is as follows: a segment of deoxyribonucleic acid (DNA) carrying the code for a specific polypeptide. Each molecule of messenger RNA (mRNA) is a transcribed copy of a gene that is used by a cell for synthesizing a polypeptide chain. If a protein contains two or more different polypeptide chains, each chain is coded by a different gene. We turn now to the question of how the sequence of nucleotides in a molecule of ribonucleic acid (RNA) is translated into an amino acid sequence. How can a molecule containing just 4 different nucleotides specify the sequence of the 20 amino acids that occur in proteins? If each nucleotide coded for 1 amino acid, then obviously the nucleic acids could code for only 4 amino acids. What if amino acids were coded for by groups of 2 nucleotides? There are 42, or 16, different combinations of 2 nucleotides (AA, AU, AC, AG, UU, and so on). Such a code is more extensive but still not adequate to code for 20 amino acids. However, if the nucleotides are arranged in groups of 3, the number of different possible combinations is 43, or 64. Here we have a code that is extensive enough to direct the synthesis of the primary structure of a protein molecule. The genetic code can therefore be described as the identification of each group of three nucleotides and its particular amino acid. The sequence of these triplet groups in the mRNA dictates the sequence of the amino acids in the protein. Each individual three-nucleotide coding unit, as we have seen, is called a codon. Protein synthesis is accomplished by orderly interactions between mRNA and the other ribonucleic acids (transfer RNA [tRNA] and ribosomal RNA [rRNA]), the ribosome, and more than 100 enzymes. The mRNA formed in the nucleus during transcription is transported across the nuclear membrane into the cytoplasm to the ribosomes—carrying with it the genetic instructions. The process in which the information encoded in the mRNA is used to direct the sequencing of amino acids and thus ultimately to synthesize a protein is referred to as translation. Figure: Binding of an Amino Acid to Its tRNA Before an amino acid can be incorporated into a polypeptide chain, it must be attached to its unique tRNA. Each tRNA molecule has an anticodon for the amino acid it carries. An anticodon is a sequence of 3 bases, and is complementary to the codon for an amino acid. For example, the amino acid lysine has the codon AAG, so the anticodon is UUC. Therefore, lysine would be carried by a tRNA molecule with the anticodon UUC. Wherever the codon AAG appears in mRNA, a UUC anticodon on a tRNA temporarily binds to the codon. This crucial process requires an enzyme known as aminoacyl-tRNA synthetase (Figure 28.5.1). There is a specific aminoacyl-tRNA synthetase for each amino acid. This high degree of specificity is vital to the incorporation of the correct amino acid into a protein. After the amino acid molecule has been bound to its tRNA carrier, protein synthesis can take place. Figure 28.5.2 depicts a schematic stepwise representation of this all-important process. Figure: The Elongation Steps in Protein Synthesis Early experimenters were faced with the task of determining which of the 64 possible codons stood for each of the 20 amino acids. The cracking of the genetic code was the joint accomplishment of several well-known geneticists—notably Har Khorana, Marshall Nirenberg, Philip Leder, and Severo Ochoa—from 1961 to 1964. The genetic dictionary they compiled, summarized in Figure 28.5.3, shows that 61 codons code for amino acids, and 3 codons serve as signals for the termination of polypeptide synthesis (much like the period at the end of a sentence). Notice that only methionine (AUG) and tryptophan (UGG) have single codons. All other amino acids have two or more codons. Figure: The Genetic Code Example A portion of an mRNA molecule has the sequence 5′‑AUGCCACGAGUUGAC‑3′. What amino acid sequence does this code for? Solution Use the Genetic Code Figure above to determine what amino acid each set of three nucleotides (codon) codes for. Remember that the sequence is read starting from the 5′ end and that a protein is synthesized starting with the N-terminal amino acid. The sequence 5′‑AUGCCACGAGUUGAC‑3′ codes for met-pro-arg-val-asp. Exercise A portion of an RNA molecule has the sequence 5′‑AUGCUGAAUUGCGUAGGA‑3′. What amino acid sequence does this code for? Further experimentation threw much light on the nature of the genetic code, as follows: The code is virtually universal; animal, plant, and bacterial cells use the same codons to specify each amino acid (with a few exceptions). The code is “degenerate”; in all but two cases (methionine and tryptophan), more than one triplet codes for a given amino acid. The first two bases of each codon are most significant; the third base often varies. This suggests that a change in the third base by a mutation may still permit the correct incorporation of a given amino acid into a protein. The third base is sometimes called the “wobble” base. The code is continuous and nonoverlapping; there are no nucleotides between codons, and adjacent codons do not overlap. The three termination codons are read by special proteins called release factors, which signal the end of the translation process. The codon AUG codes for methionine and is also the initiation codon. Thus methionine is the first amino acid in each newly synthesized polypeptide. This first amino acid is usually removed enzymatically before the polypeptide chain is completed; the vast majority of polypeptides do not begin with methionine. Concept Review Exercises What are the roles of mRNA and tRNA in protein synthesis? What is the initiation codon? What are the termination codons and how are they recognized? Answers mRNA provides the code that determines the order of amino acids in the protein; tRNA transports the amino acids to the ribosome to incorporate into the growing protein chain. AUG UAA, UAG, and UGA; they are recognized by special proteins called release factors, which signal the end of the translation process. Key Takeaways In translation, the information in mRNA directs the order of amino acids in protein synthesis. A set of three nucleotides (codon) codes for a specific amino acid. Exercises Write the anticodon on tRNA that would pair with each mRNA codon. 5′‑UUU‑3′ 5′‑CAU‑3′ 5′‑AGC‑3′ 5′‑CCG‑3′ Write the codon on mRNA that would pair with each tRNA anticodon. 5′‑UUG‑3′ 5′‑GAA‑3′ 5′‑UCC‑3′ 5′‑CAC‑3′ The peptide hormone oxytocin contains 9 amino acid units. What is the minimum number of nucleotides needed to code for this peptide? Myoglobin, a protein that stores oxygen in muscle cells, has been purified from a number of organisms. The protein from a sperm whale is composed of 153 amino acid units. What is the minimum number of nucleotides that must be present in the mRNA that codes for this protein? Use Figure 28.5.3to identify the amino acids carried by each tRNA molecule in Exercise 1. Use Figure 28.5.3to identify the amino acids carried by each tRNA molecule in Exercise 2. Use Figure 28.5.3to determine the amino acid sequence produced from this mRNA sequence: 5′‑AUGAGCGACUUUGCGGGAUUA‑3′. Use Figure 28.5.3to determine the amino acid sequence produced from this mRNA sequence: 5′‑AUGGCAAUCCUCAAACGCUGU‑3′ Answers 3′‑AAA‑5′ 3′‑GUA‑5′ 3′‑UCG‑5′ 3′‑GGC‑5′ 27 nucleotides (3 nucleotides/codon) 1a: phenyalanine; 1b: histidine; 1c: serine; 1d: proline met-ser-asp-phe-ala-gly-leu Contributors and Attributions Dr. Dietmar Kennepohl FCIC (Professor of Chemistry, Athabasca University) Prof. Steven Farmer (Sonoma State University)